View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2837_low_43 (Length: 260)
Name: NF2837_low_43
Description: NF2837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2837_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 32773668 - 32773917
Alignment:
| Q |
1 |
tatattgagctctacacaggttctttttatatttggtctaatatgtttaatcactcaaatcctcagcattttggaaaacatttataattaattctaaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32773668 |
tatattgagctctacacaggttctttttatatttggtctaatatgtttaatcactcaaatcctcagcattttggaaaacatttataattaattctaaaag |
32773767 |
T |
 |
| Q |
101 |
agtggctcgaaaacatttaggctttgaattataatgtagtacatatgaacttgcaggaagctgttgttgatccaccatatgtagcctttgcaattaggcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32773768 |
agtggctcgaaaacatttaggctttgaattataatgtagtacatatgaacttgcaggaagctgttgttgatccaccatatgtagcctttgcaattaggcc |
32773867 |
T |
 |
| Q |
201 |
taatccaggagtttgggaatacgtacgtgtcaattctgaggacctctctg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32773868 |
taatccaggagtttgggaatacgtacgtgtcaattctgaggacctctctg |
32773917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 150 - 221
Target Start/End: Complemental strand, 29121494 - 29121423
Alignment:
| Q |
150 |
cttgcaggaagctgttgttgatccaccatatgtagcctttgcaattaggcctaatccaggagtttgggaata |
221 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||||||||| | ||||| | || |||||||||||||| |
|
|
| T |
29121494 |
cttgcaggaagctattgttgatccaccatatgttgcctttgcagtaaggccagaccctggagtttgggaata |
29121423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University