View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2837_low_44 (Length: 251)

Name: NF2837_low_44
Description: NF2837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2837_low_44
NF2837_low_44
[»] chr1 (2 HSPs)
chr1 (9-251)||(15171697-15171939)
chr1 (78-251)||(34017216-34017389)
[»] chr4 (1 HSPs)
chr4 (158-230)||(54659554-54659626)


Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 9 - 251
Target Start/End: Original strand, 15171697 - 15171939
Alignment:
9 gagatgaacgtagaggataacaccacaagaccaggcatcagctttagatccgtcgtatccaatccggccgagaatctccggcgcggtgtacgccggcgtt 108  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
15171697 gagaagaacgtagaggataacaccacaagaccaggcatcagctttagatccgtcgtatccaatccggccgagaatctccggcgcggtgtacgccggcgta 15171796  T
109 ccacaagctgtatgcagaagaccgtttttgagctgttccggcaacgccgagagaccgaaatcggaaaccttgagattaccttcagcgtcgaggaggagat 208  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
15171797 ccacaagctgtatgcagaagaccgtttttgagctgctccggcaacgccgagagaccgaaatcggaaaccttgagattaccttcagcatcgaggaggagat 15171896  T
209 tctgcggtttgagatcgcggtgagcgataccgttacggtggca 251  Q
    |||||||||||||||||||||||||||||||||||||||||||    
15171897 tctgcggtttgagatcgcggtgagcgataccgttacggtggca 15171939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 78 - 251
Target Start/End: Original strand, 34017216 - 34017389
Alignment:
78 gagaatctccggcgcggtgtacgccggcgttccacaagctgtatgcagaagaccgtttttgagctgttccggcaacgccgagagaccgaaatcggaaacc 177  Q
    ||||||||||||||| |||||||||||||| |||||||| || || || || |||| |||||| ||||| || |  || |||||||||||||||||||||    
34017216 gagaatctccggcgcagtgtacgccggcgtaccacaagcagtgtggagtagtccgtctttgagatgttcaggaagagcagagagaccgaaatcggaaacc 34017315  T
178 ttgagattaccttcagcgtcgaggaggagattctgcggtttgagatcgcggtgagcgataccgttacggtggca 251  Q
    |||||||| || || ||||||||||||||||| |||||||| ||||| ||||||||||  ||||||||||||||    
34017316 ttgagattcccatcggcgtcgaggaggagattttgcggtttaagatcacggtgagcgacgccgttacggtggca 34017389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 230
Target Start/End: Complemental strand, 54659626 - 54659554
Alignment:
158 agagaccgaaatcggaaaccttgagattaccttcagcgtcgaggaggagattctgcggtttgagatcgcggtg 230  Q
    ||||||| ||||| || || ||||||||||| ||  |||||||||||||||||| ||| |||||||| |||||    
54659626 agagaccaaaatcagagactttgagattaccgtcttcgtcgaggaggagattctccggcttgagatcacggtg 54659554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University