View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2837_low_48 (Length: 249)
Name: NF2837_low_48
Description: NF2837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2837_low_48 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 13 - 249
Target Start/End: Original strand, 8176065 - 8176297
Alignment:
| Q |
13 |
aatatcgctaaataactagttgctaatattatgaccaatttgtcaattttggtctataaaccgatttgtcactaaatcagttactatatcacaatctttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8176065 |
aatatcgctaaataactagttgctaatattatgaccgatttgtcaattttggtctataaaccgat----cactaaatcagttactatatcacaatctttt |
8176160 |
T |
 |
| Q |
113 |
ttgtagttttgcaagcataatattaatgacatggaagtgctatagtatatgctacctggacaatcctgtaaagaccaggaatagacattgcatcagctcc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8176161 |
ttgtagttttgcaagcataatattaatgacatggaagtgctatagtatatgctacctggacaatcctgtaaagaccaggaatagacattgcatcagctcc |
8176260 |
T |
 |
| Q |
213 |
aagtagttttaatccaaaatcaacatgtggctgcaat |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8176261 |
aagtagttttaatccaaaatcaacatgtggctgcaat |
8176297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University