View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2837_low_55 (Length: 243)
Name: NF2837_low_55
Description: NF2837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2837_low_55 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 139
Target Start/End: Complemental strand, 34341213 - 34341074
Alignment:
| Q |
1 |
cttgttctaaactatgcaattaaaaa-cttagtactattattattttatcacccctatcactcacacacaaggttatgataaattaaacaatnnnnnnnc |
99 |
Q |
| |
|
|||||||||||| ||||||||||||| |||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |
|
|
| T |
34341213 |
cttgttctaaacaatgcaattaaaaaacttattactattattattttatcacccccatcactcacacacaaggttatgataaattaaacaataaaaaaac |
34341114 |
T |
 |
| Q |
100 |
aaaattagttcacaacttcccatcatttaattgttgtcat |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34341113 |
aaaattagttcacaacttcccatcatttaattgttgtcat |
34341074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 189 - 227
Target Start/End: Complemental strand, 34341024 - 34340986
Alignment:
| Q |
189 |
cacattgtttgcgtcatcctaagtccatttagatctata |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34341024 |
cacattgtttgcgtcatcctaagtccatttagatctata |
34340986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University