View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2837_low_61 (Length: 232)
Name: NF2837_low_61
Description: NF2837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2837_low_61 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 98 - 215
Target Start/End: Complemental strand, 17392305 - 17392188
Alignment:
| Q |
98 |
gatgcatcattatcatctatcatacctcacatacagttagatacttgacattataaactgctttgaacggcacattgaacaaactgatacaagccaatat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17392305 |
gatgcatcattatcatctatcatacctcacatacagttagatacttgacattataaactgctttgaacggcacattgaacaaactgatacaagccaatat |
17392206 |
T |
|
| Q |
198 |
caacttggacaagtgttt |
215 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
17392205 |
caacttggacaagtgttt |
17392188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 98 - 173
Target Start/End: Complemental strand, 17383516 - 17383444
Alignment:
| Q |
98 |
gatgcatcattatcatctatcatacctcacatacagttagatacttgacattataaactgctttgaacggcacatt |
173 |
Q |
| |
|
|||||||||||||||| ||||||||| |||| | ||||| | |||||||||||||||||| ||||||| ||||| |
|
|
| T |
17383516 |
gatgcatcattatcatatatcatacc---catatacttagaaatttgacattataaactgctgtgaacgggacatt |
17383444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 98 - 215
Target Start/End: Original strand, 26053552 - 26053671
Alignment:
| Q |
98 |
gatgcatcattatcatctatcatacctcacatacagttagatac--ttgacattataaactgctttgaacggcacattgaacaaactgatacaagccaat |
195 |
Q |
| |
|
|||| ||||| ||||| ||||||||| || |||||| ||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| || |
|
|
| T |
26053552 |
gatgaatcatcatcatatatcataccccatatacagatagatacacttgacattataaactgctttgaacggcacattgaacaattcgatacaagccgat |
26053651 |
T |
|
| Q |
196 |
atcaacttggacaagtgttt |
215 |
Q |
| |
|
||||||| ||||||||||| |
|
|
| T |
26053652 |
ttcaactttgacaagtgttt |
26053671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University