View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2838_low_14 (Length: 240)
Name: NF2838_low_14
Description: NF2838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2838_low_14 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 26 - 240
Target Start/End: Complemental strand, 39846225 - 39846020
Alignment:
| Q |
26 |
ctttcggccttggttcgcagcatcaatcaaattattattattctagttctggctaatgttgatttatgcaaacttcttctccaaggcagatggcacaaaa |
125 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39846225 |
ctttcggccttggttctcagcatcaatcaaattattatt---------ctagctaatgttgatttatgcaaacttcttctccaaggcagatggcacaaaa |
39846135 |
T |
 |
| Q |
126 |
catggttgcgttgtcgattcaagatgtcaaaagaatggaatcttatatccaattagaattagctttgttattgatgcaaaagtcagaggccatgaatgag |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39846134 |
catggttgcgttgtcgattcaagatgtcaaaagaatggaatcttatatccaattagaattagctttgttattgatgcaaaagtcagaggccatgaatgag |
39846035 |
T |
 |
| Q |
226 |
ttacaagtggcatat |
240 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
39846034 |
ttacaagtggcatat |
39846020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University