View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2838_low_16 (Length: 206)
Name: NF2838_low_16
Description: NF2838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2838_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 24 - 187
Target Start/End: Original strand, 18221066 - 18221229
Alignment:
| Q |
24 |
gtccctactctggcgttaaaaatgacacctttttccttccgaatcacaggtaaaggttcaaccttttgctcctcatgacggcccaagaaccgaacttgcc |
123 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18221066 |
gtccctactctggccttaaaaatgacacctttttccttctgaatcacaggtaaaggttcaaccttttgctcctcatgacggcccaagaaccgaacttgcc |
18221165 |
T |
|
| Q |
124 |
ggcgttggccccactgcatcataccagagaacttgatctcagacaaacatgaaccctgcttggg |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18221166 |
ggcgttggccccactgcatcataccagagaacttgatctcagacaaacatgaaccctgcttggg |
18221229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 71 - 187
Target Start/End: Original strand, 43012828 - 43012944
Alignment:
| Q |
71 |
aggtaaaggttcaaccttttgctcctcatgacggcccaagaaccgaacttgccggcgttggccccactgcatcataccagagaacttgatctcagacaaa |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |||||||| ||| |||||||||||| || |
|
|
| T |
43012828 |
aggtaaaggttcaaccttttgctcctcatgacgccccaagaaccgaacttgttggcgttggccccactgcaccataccagtgaatttgatctcagaccaa |
43012927 |
T |
|
| Q |
171 |
catgaaccctgcttggg |
187 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
43012928 |
catgaaccctgcttggg |
43012944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University