View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2838_low_17 (Length: 203)
Name: NF2838_low_17
Description: NF2838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2838_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 17 - 188
Target Start/End: Original strand, 11078556 - 11078728
Alignment:
| Q |
17 |
acagaatggcgggcaaccttatacaaatgagttatttgcagaactaaaggtggaggtttt-gctagttttacaatcttgtttcttaaatcttggaaaagt |
115 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||||| |||||||| || ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11078556 |
acagaatggcgggcaaccttatacagatgagttgtttgcagaactaaaggtagaggtttttgcaagtttcacaatcttgtttcttaaatcttggaaaagt |
11078655 |
T |
|
| Q |
116 |
atcatgatatccgtgaattcatatatttattgcagaaaggagcaatgaaactgcatagagagcgaagaaaggt |
188 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11078656 |
atcatgatatcagtgaattcatatatttattgcagaaaggagcaatgaaactgcatagagagcaaagaaaggt |
11078728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 18 - 167
Target Start/End: Original strand, 11089925 - 11090075
Alignment:
| Q |
18 |
cagaatggcgggcaaccttatacaaatgagttatttgcagaactaaaggtggaggtttt-gctagttttacaatcttgtttcttaaatcttggaaaagta |
116 |
Q |
| |
|
|||||||| |||||||| |||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11089925 |
cagaatggtgggcaaccctatacacatgagttatttgcagaactaaaggtggaggtttttgctagtttcacaatcttgtttcttaaatcttggaaaagta |
11090024 |
T |
|
| Q |
117 |
tcatgatatccgtgaattcatatatttattgcagaaaggagcaatgaaact |
167 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11090025 |
tcatgatataagtgaattcatatattgattgcagaaaggagcaatgaaact |
11090075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University