View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2839_high_12 (Length: 295)
Name: NF2839_high_12
Description: NF2839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2839_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 16 - 276
Target Start/End: Complemental strand, 43629059 - 43628797
Alignment:
| Q |
16 |
atagtcaaatgaattagtcattgtgaaaacctatatccgttcacaatttcc-acccacaatattataacgtggcccnnnnnnnnnnnnnnnnnnccagta |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
43629059 |
atagtcaaatgaattagtcattgtgaaaacctatatccgttcacaatttcccacccacaatattataacgtggcccttttattttttcctttttccagta |
43628960 |
T |
 |
| Q |
115 |
ggtcttttgtgtgtgtttagtttcaaacttctttgaaaataatgaaacattggtatccaaagttatctggacaaggccaatagccatggacgtaggtaat |
214 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43628959 |
ggtctcttgtgtgtgtttagtttcaaacttctttgaaaataatgaaacattggtatccaaagttatctggacaaggccaatagccatggacgtaggtaat |
43628860 |
T |
 |
| Q |
215 |
taaatggaccccaat-aacacaaccacttcacttgctttggttttggttttatttgggagagt |
276 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43628859 |
taaatggaccccaataaacacaaccacttcacttgctttggttttggttttatttgggagagt |
43628797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University