View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2839_high_17 (Length: 234)
Name: NF2839_high_17
Description: NF2839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2839_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 55; Significance: 9e-23; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 156 - 218
Target Start/End: Original strand, 5415832 - 5415894
Alignment:
| Q |
156 |
aacttatataaagatatcttttggaagaagagttcttcaaaatagtagtggtatgcttttcat |
218 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5415832 |
aacttatataaagatatcttttggaataagagttcttcaaaatagtagtggtatgcatttcat |
5415894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 19 - 67
Target Start/End: Original strand, 5415683 - 5415731
Alignment:
| Q |
19 |
gttattactgcagtagccaccgataacagagcggtaatgtttcctactc |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5415683 |
gttattactgcagtagccaccgataacagagcggtaatgtttcctactc |
5415731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University