View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2839_low_22 (Length: 255)
Name: NF2839_low_22
Description: NF2839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2839_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 5415644 - 5415731
Alignment:
| Q |
1 |
tttgtaatcgagttcatatgcactttcttccttatgtttgttattactgcagtagccaccgataacagagcggtaatgtttcctactc |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5415644 |
tttgtaatcgagttcatatgcactttcttccttatgtttgttattactgcagtagccaccgataacagagcggtaatgtttcctactc |
5415731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 177 - 239
Target Start/End: Original strand, 5415832 - 5415894
Alignment:
| Q |
177 |
aacttatataaagatatcttttggaagaagagttcttcaaaatagtagtggtatgcttttcat |
239 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5415832 |
aacttatataaagatatcttttggaataagagttcttcaaaatagtagtggtatgcatttcat |
5415894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 21 - 77
Target Start/End: Complemental strand, 5407186 - 5407130
Alignment:
| Q |
21 |
cactttcttccttatgtttgttattactgcagtagccaccgataacagagcggtaat |
77 |
Q |
| |
|
|||||||| ||||||||| || ||| ||| ||| ||||||||||| ||||||||||| |
|
|
| T |
5407186 |
cactttctaccttatgttcgtcatttctggagttgccaccgataatagagcggtaat |
5407130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University