View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2839_low_8 (Length: 380)
Name: NF2839_low_8
Description: NF2839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2839_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 1 - 306
Target Start/End: Original strand, 5657163 - 5657468
Alignment:
| Q |
1 |
actggacaataaaatccgcctttgttatgacccggcagattgggttaaattttcttcctaaagatggttcctttggtaaaatgtctggaagcactactct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5657163 |
actggacaataaaatccgcctttgttatgacccggcagattgggttaaattttcttcctaaaaatggttcctttggtaaaatgtctggaagcactactct |
5657262 |
T |
 |
| Q |
101 |
ttttatgagtcgaaggggaaacttgtattgtaatggaacttatagggtttcgtggtcgtggcggtgtcgggatgtcattctctcaggtgctggccaggat |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5657263 |
ttttataagtcgaaggggaaacttgtattgtaatggaacttatagggtttcgtagtggtggcggtgtcgggatgtcattctctcaggtgctggccaggat |
5657362 |
T |
 |
| Q |
201 |
ccacttgtacctaccgctcaatggcggtttgttctgattcctttcttctggagggacttggtgttctttggttcggtgggtgctttcttggcaggtcttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5657363 |
ccacttgtacctaccgctcaatggcggtttgttctgattcctttcttctggagggacttggtgttctttggttcggtgggtgctttcttggcaggtcttt |
5657462 |
T |
 |
| Q |
301 |
cccggc |
306 |
Q |
| |
|
|||||| |
|
|
| T |
5657463 |
cccggc |
5657468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University