View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2840_high_14 (Length: 346)
Name: NF2840_high_14
Description: NF2840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2840_high_14 |
 | |
|
| [»] chr5 (3 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 135 - 346
Target Start/End: Complemental strand, 13168218 - 13168007
Alignment:
| Q |
135 |
ggtagaataaagattttgtgagtgtgtgagaaatttatatttggaatagcaaccatttgcaagaataatccatgggatagcctaaggtcccttttttcag |
234 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13168218 |
ggtagaataaatattttgtgagtgtgtgagaaatttatatttggaatagcaaccatttgcaagaataatccatgggatagcctaaggtcccttttttcag |
13168119 |
T |
|
| Q |
235 |
gacatcaaatatttgtgatgttgcttagtagtatataaaaatgaacattttatattttggcgacccaatttcattgataaacaaccttgagaatctacta |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13168118 |
gacatcaaatatttgtgatgttgcttagtagtatataaaaatgaacattttatattttggtgacccaatttcattgataaacaaccttgagaatctacta |
13168019 |
T |
|
| Q |
335 |
aattatacattt |
346 |
Q |
| |
|
|||||||||||| |
|
|
| T |
13168018 |
aattatacattt |
13168007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 13168328 - 13168276
Alignment:
| Q |
19 |
aaacgagtctttcttggtcacatacatataatattgtcttagacatactaatg |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13168328 |
aaacgagtctttcttggtcacatacatataatattgtcttagacatactaatg |
13168276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 283 - 346
Target Start/End: Complemental strand, 12850540 - 12850478
Alignment:
| Q |
283 |
tttatattttggcgacccaatttcattgataaacaaccttgagaatctactaaattatacattt |
346 |
Q |
| |
|
|||||||||||| |||| |||||| ||||| |||||||||||||||| ||||||||||| |||| |
|
|
| T |
12850540 |
tttatattttggtgacc-aatttctttgatgaacaaccttgagaatccactaaattataaattt |
12850478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University