View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2840_high_22 (Length: 257)
Name: NF2840_high_22
Description: NF2840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2840_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 34747291 - 34747540
Alignment:
| Q |
1 |
tttcaaattactttgtttgagtgagtcttctttctcatgaagggcatgagtgagcaagcatggctgtgctaaattgtagtacttggttaatttgaagatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34747291 |
tttcaaattactttgtttgagtgagtcttctttctcatgaaggacatgagtgagcaagcatggctgtgctaaattgtagtacttggttaatttgaagatt |
34747390 |
T |
 |
| Q |
101 |
cttgtatgca--nnnnnnnnnnctttctgtagtacttgtatgaatatttctannnnnnngttgctttggaaatgagcatattgctagttctatttgtcaa |
198 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34747391 |
cttgtatgcatgttttttttttctttctgtagtacttgtatgaatatttctatttttttgttgttttggaaatgagcatattgctatttctatttgtcaa |
34747490 |
T |
 |
| Q |
199 |
gtctccattttcttttgtttgtttagtttaatcttcatcctatctctgct |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34747491 |
gtctccattttcttttgtttgtttagtttaatcttcatcctatctctgct |
34747540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University