View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2840_high_23 (Length: 257)
Name: NF2840_high_23
Description: NF2840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2840_high_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 20 - 218
Target Start/End: Original strand, 36687604 - 36687812
Alignment:
| Q |
20 |
actaccatgtatataaggtatagtcgcatatattgcttatgta--gtgaaaggcattatgaaagagttgtagattaatgcataattttcttttgttattt |
117 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36687604 |
actaccatgtatataaggtataatcacatatattgcttatgtatagtgaaaggcattatgaaagagttgtagattaatgcataattttcttttgttattt |
36687703 |
T |
|
| Q |
118 |
gataataacatcaacgcattgta--------atttttcatttttgttgtttcaatcgctccatcaacgggacaatttgatgctacttgttgtacttttgt |
209 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36687704 |
gataataacatcaacgcattgtaactttattatttttcattgttgttgtttcaatcgctccatcaacgggacaatttgatgctacttgttgtacttttgt |
36687803 |
T |
|
| Q |
210 |
gtttatttg |
218 |
Q |
| |
|
||||||||| |
|
|
| T |
36687804 |
gtttatttg |
36687812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 217
Target Start/End: Complemental strand, 56339834 - 56339768
Alignment:
| Q |
152 |
ttgttgtttcaatcgctccatcaacgggacaatttgatgctac-ttgttgtacttttgtgtttattt |
217 |
Q |
| |
|
|||||||||| || |||| ||||||||||||||||||| |||| ||||||||||||| ||||||||| |
|
|
| T |
56339834 |
ttgttgtttcgatggctctatcaacgggacaatttgatactactttgttgtacttttatgtttattt |
56339768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University