View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2840_high_29 (Length: 240)

Name: NF2840_high_29
Description: NF2840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2840_high_29
NF2840_high_29
[»] chr3 (1 HSPs)
chr3 (2-225)||(34747098-34747313)


Alignment Details
Target: chr3 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 2 - 225
Target Start/End: Complemental strand, 34747313 - 34747098
Alignment:
2 cactcaaacaaagtaatttgaaagataagtagattatagtataaaccatacataaccaacttggtcaagaaagtgtgtgtgtgcgtgagcgcgtgtatga 101  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||    |||||||||||    
34747313 cactcaaacaaagtaatttgaaagataagtagattatagtataaaccatacataaccaacttggtcaaaaaagtgtgtgcgtgcg----cgcgtgtatga 34747218  T
102 gatttttgttggtgaacagatcgatgtatatccgtgcacaactgcggagactgaattctcaaggtcaagaggactgatgtgagacttaccggtgattaga 201  Q
    |||||||||||||||||||||    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||    
34747217 gatttttgttggtgaacagat----gtatatccgtgcacaactgcggagactgaattctcaaggtcaagaggaccgatgtgagacttaccagtgattaga 34747122  T
202 gcggttagaccggaaggaaggaaa 225  Q
    ||||||||||||||||||||||||    
34747121 gcggttagaccggaaggaaggaaa 34747098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University