View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2840_high_33 (Length: 232)

Name: NF2840_high_33
Description: NF2840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2840_high_33
NF2840_high_33
[»] chr7 (1 HSPs)
chr7 (18-224)||(21396831-21397037)


Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 224
Target Start/End: Original strand, 21396831 - 21397037
Alignment:
18 ttttctagatatattttggctggtatagcagctgctatctgacacatctatgagacccccatgaacttattaaatgaccaagattcaggaagttaataat 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21396831 ttttctagatatattttggctggtatagcagctgctatctgacacatctatgagacccccatgaacttattaaatgaccaagattcaggaagttaataat 21396930  T
118 tattatgaatgacaataataacgcattcaccaccgacaccccaaaactagatctcccctaacttggcatttattgtagtagaaaaaattgaaatatgatt 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21396931 tattatgaatgacaataataacgcattcaccaccgacaccccaaaactagatctcccctaacttggcatttattgtagtagaaaaaattgaaatatgatt 21397030  T
218 gatgatg 224  Q
    |||||||    
21397031 gatgatg 21397037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University