View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2840_low_22 (Length: 308)
Name: NF2840_low_22
Description: NF2840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2840_low_22 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 11 - 308
Target Start/End: Original strand, 30475650 - 30475947
Alignment:
| Q |
11 |
cacagaaagggcgaccagatgcagaaagggggttgttgaagtgtgatgaaggggagaaacatgatgcataaccagagaaaaactctttccttcacaattt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
30475650 |
cacagaaagggcgaccagatgcagaaagggggttgttgaagtgtgatgaaggggagaaacatgatgcataaccagggaaaaactctttgcttcacaattt |
30475749 |
T |
 |
| Q |
111 |
ggttgcatgcgtccatgtttttagaggcgcgccagtcgaaggttttgatcagcctaagtaatttagtttcaatgaacaattggccatgatcttgctgaaa |
210 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30475750 |
ggttgcatgcgtccgtgtttttagaggcgcgcgagtcgaaggttttgatcagcctaagtaatttagtttcaatgaacaattggcaatgatcttgctgaaa |
30475849 |
T |
 |
| Q |
211 |
ttcaaactgcaattacaatgacatttttgtactgtctcttgcatcgtagaagattgatgttgaatttattattaatgttattttggcgccatattatt |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30475850 |
ttcaaactgcaattacaatgacatttttgtactatctcttgcatcgtagaagattgatgttgaatttattattaatgttattttggcgccatattatt |
30475947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University