View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2840_low_29 (Length: 254)
Name: NF2840_low_29
Description: NF2840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2840_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 13 - 224
Target Start/End: Complemental strand, 36216155 - 36215944
Alignment:
| Q |
13 |
aatattaaggattaaatttgacatatggtatagatttatttttaggcattatcttacctttttgaaagtttggtaggacttgtcaacttaagtctaaaat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36216155 |
aatattaaggattaaatttgacatatggtatagatttatttttaggcattatcttacctttttgaaagtttggtaggacttgtcaacttaagtctaaaat |
36216056 |
T |
 |
| Q |
113 |
attatattaatatcaaatcgatttgtaaggtgatgattgctcaaattttataagcactatacattctttaaaacaaaaacactatacatttgatgacgtg |
212 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36216055 |
attatattaatatcaaatcgatatgtaaggtgatgattgctcaaactttataagcactatacattctttaaaacaaaaacactatacatgtgatgacgtg |
36215956 |
T |
 |
| Q |
213 |
acaataaaaaat |
224 |
Q |
| |
|
|||||||||||| |
|
|
| T |
36215955 |
acaataaaaaat |
36215944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University