View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2840_low_33 (Length: 240)
Name: NF2840_low_33
Description: NF2840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2840_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 2 - 225
Target Start/End: Complemental strand, 34747313 - 34747098
Alignment:
| Q |
2 |
cactcaaacaaagtaatttgaaagataagtagattatagtataaaccatacataaccaacttggtcaagaaagtgtgtgtgtgcgtgagcgcgtgtatga |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| ||||||||||| |
|
|
| T |
34747313 |
cactcaaacaaagtaatttgaaagataagtagattatagtataaaccatacataaccaacttggtcaaaaaagtgtgtgcgtgcg----cgcgtgtatga |
34747218 |
T |
 |
| Q |
102 |
gatttttgttggtgaacagatcgatgtatatccgtgcacaactgcggagactgaattctcaaggtcaagaggactgatgtgagacttaccggtgattaga |
201 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
34747217 |
gatttttgttggtgaacagat----gtatatccgtgcacaactgcggagactgaattctcaaggtcaagaggaccgatgtgagacttaccagtgattaga |
34747122 |
T |
 |
| Q |
202 |
gcggttagaccggaaggaaggaaa |
225 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
34747121 |
gcggttagaccggaaggaaggaaa |
34747098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University