View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2841_low_10 (Length: 239)
Name: NF2841_low_10
Description: NF2841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2841_low_10 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 239
Target Start/End: Complemental strand, 40383634 - 40383413
Alignment:
| Q |
18 |
aatccgtgagcttgaagagactcccggaggaacaaaaagccttgtagagttcaacaagtcatggcagttaaagtataaaccagcatctgtaactgccgtt |
117 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40383634 |
aatccgtgagcttgaagaaaatcccggaggaacaaaaagccttgtagagttcaacaagtcatggcagttaaagtataaaccagcatctgtaactgccgtt |
40383535 |
T |
 |
| Q |
118 |
aacggacctaaaatgtcgttaaaagacgccatcagtgccagtatctcaagagggaaattagtctcaggaactaatggtggtaatggaaacggtaactcaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
40383534 |
aacggacctaaaatgtcgttaaaagacgccatcagtgcgagtatctcaagagggaaattagtctcaggaactaacggtggtaatggcaacggtaactcaa |
40383435 |
T |
 |
| Q |
218 |
ttgcgtcctcagttgccacttt |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
40383434 |
ttgcgtcctcagttgccacttt |
40383413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University