View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2841_low_8 (Length: 258)
Name: NF2841_low_8
Description: NF2841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2841_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 32290742 - 32290520
Alignment:
| Q |
18 |
atgaaagagaaaatatacatatgcagttggggttggtgctaaaattaaatactcttccttttcnnnnnnnacgcaaaaattaaatactcttcctaactag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32290742 |
atgaaagagaaaatatacatatgcagttggggttggtgctaaaattaaatactcttccttttctttttttacgcaaaaattaaatactcttcctaactag |
32290643 |
T |
|
| Q |
118 |
tgatatatatgatactattattttaaggatatgacacaatgatgatgatgatccaccggaacccgttggaaatgggaaaggcaactactttgccactgaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32290642 |
tgatatatatgatactattattttaaggatatgacacaatgatgatgatgatccaccggaacccgttggaaatgggaaaggcaactactttgccactgaa |
32290543 |
T |
|
| Q |
218 |
tac-ttgctggattggagatgtgg |
240 |
Q |
| |
|
| | ||||||| |||||||||||| |
|
|
| T |
32290542 |
tgctttgctgg-ttggagatgtgg |
32290520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University