View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2843_high_2 (Length: 238)

Name: NF2843_high_2
Description: NF2843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2843_high_2
NF2843_high_2
[»] chr1 (2 HSPs)
chr1 (1-220)||(27755487-27755706)
chr1 (122-208)||(27766159-27766245)


Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 27755706 - 27755487
Alignment:
1 cgactatagcaagaaagcaaacagggaagcgtattgagttaggtgctaatagcaaaaccacgtcgcctcgtcgaataccaaggtggagcaaagatcggga 100  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||    
27755706 cgactatagcaaggaagcaaacagggaagcgtattgagttaggtgctaatagcaaaaccacgtcgcctcgtcgaataccaaggtggagcaaagagtggga 27755607  T
101 gagggcggagacatggattttgagctggcggaaggtaagggagttgccggtttcggcgtcagcgagggcgattgtgtcggcgacagaggaagtagattgg 200  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||    
27755606 gagggcggaaacatggattttgagctggcggaaggtaagggagttgccggtttcggcgtcagcgagggcgatggtgtcggcgacagaggaagttgattgg 27755507  T
201 aagaggaaggaggttaaaga 220  Q
    ||||||||||||||||||||    
27755506 aagaggaaggaggttaaaga 27755487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 122 - 208
Target Start/End: Complemental strand, 27766245 - 27766159
Alignment:
122 gagctggcggaaggtaagggagttgccggtttcggcgtcagcgagggcgattgtgtcggcgacagaggaagtagattggaagaggaa 208  Q
    ||||||||||||||| ||| | |  ||||||| |||||| |  |||||||| ||||||||| | |||||||| ||||||||||||||    
27766245 gagctggcggaaggttaggaattcaccggtttgggcgtcggtaagggcgatggtgtcggcggcggaggaagtggattggaagaggaa 27766159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University