View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2843_high_2 (Length: 238)
Name: NF2843_high_2
Description: NF2843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2843_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 27755706 - 27755487
Alignment:
| Q |
1 |
cgactatagcaagaaagcaaacagggaagcgtattgagttaggtgctaatagcaaaaccacgtcgcctcgtcgaataccaaggtggagcaaagatcggga |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27755706 |
cgactatagcaaggaagcaaacagggaagcgtattgagttaggtgctaatagcaaaaccacgtcgcctcgtcgaataccaaggtggagcaaagagtggga |
27755607 |
T |
 |
| Q |
101 |
gagggcggagacatggattttgagctggcggaaggtaagggagttgccggtttcggcgtcagcgagggcgattgtgtcggcgacagaggaagtagattgg |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
27755606 |
gagggcggaaacatggattttgagctggcggaaggtaagggagttgccggtttcggcgtcagcgagggcgatggtgtcggcgacagaggaagttgattgg |
27755507 |
T |
 |
| Q |
201 |
aagaggaaggaggttaaaga |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
27755506 |
aagaggaaggaggttaaaga |
27755487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 122 - 208
Target Start/End: Complemental strand, 27766245 - 27766159
Alignment:
| Q |
122 |
gagctggcggaaggtaagggagttgccggtttcggcgtcagcgagggcgattgtgtcggcgacagaggaagtagattggaagaggaa |
208 |
Q |
| |
|
||||||||||||||| ||| | | ||||||| |||||| | |||||||| ||||||||| | |||||||| |||||||||||||| |
|
|
| T |
27766245 |
gagctggcggaaggttaggaattcaccggtttgggcgtcggtaagggcgatggtgtcggcggcggaggaagtggattggaagaggaa |
27766159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University