View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2843_high_4 (Length: 231)
Name: NF2843_high_4
Description: NF2843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2843_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 18168812 - 18169020
Alignment:
| Q |
1 |
attggacacgacaatgatttctctttagagtgcatggccattagtggcaattcaagtgaaatagcactagaatttttgatgtctcttatatcttctaatg |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18168812 |
attggacacgacaatgatttctcttctgagtgcatggccattagtggcaattcaagtgaaatagcactagaatttttgaagtctcttatatcttctaatg |
18168911 |
T |
 |
| Q |
101 |
aatgtttctcttcctttctctctgagctctcagaagatgtcaatgaactttccaatgaacacaaagaagttccattgtcatgtttcctctcctcgtagtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18168912 |
aatgtttctcttcctttctctctgagctctcagaagatgtcaaagaactttccaatgaacacaaagaagttccattttcatgtttcctctcctcgtagtt |
18169011 |
T |
 |
| Q |
201 |
taaacttaa |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
18169012 |
taaacttaa |
18169020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University