View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2843_low_1 (Length: 537)
Name: NF2843_low_1
Description: NF2843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2843_low_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 307 - 527
Target Start/End: Original strand, 41752532 - 41752752
Alignment:
| Q |
307 |
tttagaatcatattcatcttcatccgtgaaactcttattgtttatggttccactcataatagttgctggtctagtttctgtgttgggtcctaatccttct |
406 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41752532 |
tttagaatcatattcatcttcatccatgaaactcttattgtttatggttccactcataatagttgctggtctagtttccgtgttgggtcctaatccttct |
41752631 |
T |
|
| Q |
407 |
aattggacttctattccaaactcaagtggtgatgatgttacaacaaaaactatggagaaggctcaacttgttgtggctgctgctgttgattttcataaca |
506 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41752632 |
aattggacttctattccaaacccaagtggtgatgatgttacaacaaaaactatggagaaggctcaagttgttgtggctgctgctgttgattttcataaca |
41752731 |
T |
|
| Q |
507 |
aagaagtcaaagctatctctg |
527 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
41752732 |
aagaagtcaaagctatctctg |
41752752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 146; E-Value: 1e-76
Query Start/End: Original strand, 107 - 260
Target Start/End: Original strand, 41752324 - 41752477
Alignment:
| Q |
107 |
ctcgaagtttaaggggagagtattaagacgcatgtcaatgatatcacaccaatttattaccaagattcttcctataaatactatcccaccaaaaacttct |
206 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41752324 |
ctcgaagtttaaggggagaatattaagacgcatgtcaatgatatcacaccaatttattaccaagattcttcctataaatactatcccaccaaaaacttct |
41752423 |
T |
|
| Q |
207 |
ctgttttaatcctcccctacttctactcttctctctttcttaatttctcccacc |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41752424 |
ctgttttaatcctcccctacttctactcttctctcttttttaatttctcccacc |
41752477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University