View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2843_low_7 (Length: 236)
Name: NF2843_low_7
Description: NF2843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2843_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 17 - 220
Target Start/End: Complemental strand, 2097122 - 2096915
Alignment:
| Q |
17 |
agtatgaagcatttattatgcttaacagacaacgtttaactaataacgtatctatatacaaatggcttgcatgcatg----aacataatccgactttaca |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2097122 |
agtatgaagcatttattatgcttaacagacagcgtttaactaataacgtatctatatacaaatggcttgcatgcatgcatgaacataatccgactttaca |
2097023 |
T |
|
| Q |
113 |
gggtggaacccttctggcttgctctatacctcactcctcatgaataattatctaactatatttctgcaaacttctaaatatttcaattcctgaattccct |
212 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2097022 |
gggtggaatccttctggcttgctctatacctcactcctcatgaataattatctaactatatttctgctaacttctaaatatttcaattcctgaattccct |
2096923 |
T |
|
| Q |
213 |
cgtcctat |
220 |
Q |
| |
|
|||||||| |
|
|
| T |
2096922 |
cgtcctat |
2096915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University