View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2844_high_19 (Length: 250)
Name: NF2844_high_19
Description: NF2844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2844_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 7 - 242
Target Start/End: Original strand, 28035918 - 28036153
Alignment:
| Q |
7 |
tcaaattctctccctttgatactcgtccccgctatagatacattgtggttattgtggctgtggctgttgatgttgatgttgtgctttacaacatcgttgg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28035918 |
tcaaattctctccctttgatactcgtccccgctatagatacattgtggttattgtggctgtggctgttgatgttgatgttgtgcttttcaacatcgttgg |
28036017 |
T |
 |
| Q |
107 |
cattatcttctttagaatccttactattatttccctttatggctattgtgttagagatgacattatgcatttggttagatgtttgattagtacctgggtg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28036018 |
cattatcttctttagaatccttactattatttccctttatggctattgtgttagagatgacattatgcatttggttagatgtttgattagtacctgggtg |
28036117 |
T |
 |
| Q |
207 |
agcaacaagcttataatcttcatgagcacctttgct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
28036118 |
agcaacaagcttataatcttcatgagcacctttgct |
28036153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University