View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2844_high_24 (Length: 208)
Name: NF2844_high_24
Description: NF2844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2844_high_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 10 - 195
Target Start/End: Complemental strand, 24557852 - 24557671
Alignment:
| Q |
10 |
agtgagaagaagagcaagggtcaggatcgtggtaattaagccttatgaaactttaggcgataaaggaaagaagaaggtgaccggtgaatctaatccaaat |
109 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24557852 |
agtgataagaggagcaagggtcaggatcgtggtaa----gccttatgaaactttaggcgataaaggaaagaagaaggtgaccggtgaatctaatccaaat |
24557757 |
T |
 |
| Q |
110 |
gggggagaagttagatactacaattgtggtggagtggaacatcgtgttgttgattgtaagaaccctaccatgacttgttataagtg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
24557756 |
gggggagaagttagatactacaattgtggtggagtggaacatcgtgttgctgattgtaagaaccctaccatgacttgttataagtg |
24557671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University