View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2844_low_21 (Length: 274)
Name: NF2844_low_21
Description: NF2844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2844_low_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 47; Significance: 7e-18; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 146 - 215
Target Start/End: Original strand, 31133880 - 31133952
Alignment:
| Q |
146 |
taatctatgaaaagtaaatctgaatcggtaaaaagg---agtatacatacctgttgtagcacgatgaatgtgt |
215 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
31133880 |
taatttatgaaaactaaatctgaatcggtaaaacggtgaagtatacatacctgttgtagcacgatgaatgtgt |
31133952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 11 - 57
Target Start/End: Original strand, 31133839 - 31133885
Alignment:
| Q |
11 |
aaagttgaaacacctttcttttgaatacatattttatatcttaattt |
57 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31133839 |
aaagtttaaacacctttcttttgaatacatattttatatcttaattt |
31133885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University