View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2844_low_27 (Length: 247)
Name: NF2844_low_27
Description: NF2844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2844_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 25 - 241
Target Start/End: Complemental strand, 737637 - 737420
Alignment:
| Q |
25 |
attctcttgtactaattattt-aatttacttaggatgtagcaaatcagannnnnnnnnnaacttatcaaattattttttcgaaaacatactgtaatatag |
123 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
737637 |
attctcttgtactaattattttaatttacttaggatgtagcaaatcagattttttttttaacttatcaaattattttttcgaaaacatactgtaatatag |
737538 |
T |
 |
| Q |
124 |
aaagtactttaattttaactatttcatgcataatttcttttgataaacaaactagcttatcattttatatgtatataatatttatctcacttatgcactt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
737537 |
aaagtactttaattttaactatttcatgcataatttcttttgataaacaaactagcttatcattttatatgtatataatatttatctcacttatgcactt |
737438 |
T |
 |
| Q |
224 |
agaatttgccatcaaatt |
241 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
737437 |
agaatttgccatcaaatt |
737420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University