View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2844_low_30 (Length: 226)
Name: NF2844_low_30
Description: NF2844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2844_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 221
Target Start/End: Original strand, 6539142 - 6539344
Alignment:
| Q |
19 |
gttacgccccatggtttatgaaaaatacatcctaactgcaactgttaagttaatttccatttgtattatgtaccttatgttttatgaagaacccatccac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6539142 |
gttacgccccatggtttatgaaaaatacatcctaactgcaactgttaagttaatttccatttgtattatgtaccttatgttttatgaagaacccatccaa |
6539241 |
T |
|
| Q |
119 |
tggattcttcaatttcttaactgcaacctacatgctcatttccatttatgttatgtattttatgtttattggttaccattgattgctattatatattctt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6539242 |
tggattcttcaatttcttaactgcaacctacatgctcatttccatttatgttatgtattttatgtttgttggttaccattgattgctattatatattctt |
6539341 |
T |
|
| Q |
219 |
cga |
221 |
Q |
| |
|
||| |
|
|
| T |
6539342 |
cga |
6539344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 31 - 97
Target Start/End: Complemental strand, 7174096 - 7174031
Alignment:
| Q |
31 |
ggtttatgaaaaatacatcctaactgcaactgttaagttaatttccatttgtattatgtaccttatg |
97 |
Q |
| |
|
|||||||||| || ||||| ||| ||||||| |||||||||||||||||| | |||||||||||||| |
|
|
| T |
7174096 |
ggtttatgaacaacacatcataattgcaact-ttaagttaatttccatttatgttatgtaccttatg |
7174031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University