View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2846_high_36 (Length: 232)
Name: NF2846_high_36
Description: NF2846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2846_high_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 12 - 216
Target Start/End: Original strand, 55329035 - 55329239
Alignment:
| Q |
12 |
gagatgaagcatgacgattcattctgtagtgatacagaagcttcttagcacaaatgcacacattggtcgtcaagtcgccactcatcatttcaaagattac |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55329035 |
gagaagaagcatgacgattcattctgtagtgatacagaagcttcttagcacaaatgcacacattggtcgtcaagtcgccactcatcatttcaaagattac |
55329134 |
T |
 |
| Q |
112 |
acttacggccttcgcaacagaatggcaatcatcgattccgataagactttgatttgtatgcgaagtgctatcaatttcatctcttcccttgctcgccata |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55329135 |
acttacggccttcgcaacagaatggcaatcatcgattccgataagactttgatttgtatgcgaagtgctatcaatttcatctcttcccttgctcgccata |
55329234 |
T |
 |
| Q |
212 |
atggt |
216 |
Q |
| |
|
||||| |
|
|
| T |
55329235 |
atggt |
55329239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University