View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2846_low_21 (Length: 278)
Name: NF2846_low_21
Description: NF2846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2846_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 11 - 227
Target Start/End: Original strand, 1808552 - 1808775
Alignment:
| Q |
11 |
taattctcatttagagaaagctttaattgtggaactaattttggaacgtgttcatgttgtggaaccaaccacttcttttaaaattacctgggattcttac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1808552 |
taattctcatttagagaaagctttaattgtggaactaattttggaacgtgttgatgttgtggaaccaaccacttcttttaaaattacctgggattcttac |
1808651 |
T |
 |
| Q |
111 |
tattatattttctggaaaacttgttcttttgaatagtgttttagtccgagaaacaaacaccctcaaatattt-------taaaaaataaaataagtgtca |
203 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1808652 |
tattatattttctggaaaacttgttcctttgaatagtgttttagtccgagaaacaaacaccctcaaatattttaaaaaataaaaaataaaataagtgtca |
1808751 |
T |
 |
| Q |
204 |
attattacggtagatgaatttata |
227 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
1808752 |
attattacggtagatgaatttata |
1808775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University