View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2846_low_24 (Length: 255)

Name: NF2846_low_24
Description: NF2846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2846_low_24
NF2846_low_24
[»] chr4 (2 HSPs)
chr4 (50-239)||(34794980-34795166)
chr4 (7-45)||(34794840-34794878)
[»] chr2 (1 HSPs)
chr2 (72-138)||(4275497-4275563)


Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 50 - 239
Target Start/End: Original strand, 34794980 - 34795166
Alignment:
50 ataattttgataagattaggaagaaggatatatgagagatttggtgaaatagaaggggacagaatagacatccgcccggaaatacagggtgaccgtacaa 149  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34794980 ataattttgataagattaggaagaaggatatatgagagatttggtgaaatagaaggggacagaatagacatccgcccggaaatacagggtgaccgtacaa 34795079  T
150 caaaaataggaatcacttctcaaacaaaaagtgactcattcactcttacttacttacttactacggtggcacacagtctttgtttttctt 239  Q
    | ||||||||| |||||||||||||||||||||||||||||| ||   ||||||||||||||||||||   |||||||||||||||||||    
34795080 ccaaaataggattcacttctcaaacaaaaagtgactcattcattcactcttacttacttactacggtg---cacagtctttgtttttctt 34795166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 7 - 45
Target Start/End: Original strand, 34794840 - 34794878
Alignment:
7 ccacatagaaaatgagattaaaatcgaagtgagaaatgg 45  Q
    |||||||||||||||||||||||||||||||||||||||    
34794840 ccacatagaaaatgagattaaaatcgaagtgagaaatgg 34794878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 72 - 138
Target Start/End: Complemental strand, 4275563 - 4275497
Alignment:
72 gaaggatatatgagagatttggtgaaatagaaggggacagaatagacatccgcccggaaatacaggg 138  Q
    ||||||||  || |||||||| |||| |||||||||||||||||||||||| |||||||||||||||    
4275563 gaaggataggtgtgagatttgatgaagtagaaggggacagaatagacatccccccggaaatacaggg 4275497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University