View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2846_low_31 (Length: 247)
Name: NF2846_low_31
Description: NF2846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2846_low_31 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 21 - 229
Target Start/End: Original strand, 30769655 - 30769863
Alignment:
| Q |
21 |
gatcacgcgttaatgaaacaatgaacgacgattccttccctaatgtccccggaggcaagcttcggctcatgtgcagctacggaggccacataatgccgcg |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30769655 |
gatcacgcgttaatgaaacaatgaacgacgattccttccctaatgtccccggaggcaagcttcggctaatgtgcagctacggaggccacataatgccgcg |
30769754 |
T |
 |
| Q |
121 |
ccctcacgataagtctttatgttatgtaggcggtgacaccagaatcgtggtcgtggatcgcagttcttctctgagagacctatgttcacgcctttcgaga |
220 |
Q |
| |
|
|||||| ||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
30769755 |
ccctcatgataagtctctatgttatgtaggtggtgacaccagaatcgtggtcgtggatcgcagttcttctctgagagacctatgttcgcgtctttcgaga |
30769854 |
T |
 |
| Q |
221 |
acaattctc |
229 |
Q |
| |
|
||||||||| |
|
|
| T |
30769855 |
acaattctc |
30769863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University