View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2846_low_33 (Length: 242)
Name: NF2846_low_33
Description: NF2846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2846_low_33 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 39676324 - 39676441
Alignment:
| Q |
1 |
cccaaagcttaaccacttaatgaaagcaaacacgcttaaccgccgcataagaccgaagctaccaaagtttacttatcaaaagaaggtaaaagatgggcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39676324 |
cccaaagcttaaccacttaatgaaagcaaacacgcttaaccgccgcataagaccgaagctaccaaagtttacttatcaaaagaaggtaaaagatgggcct |
39676423 |
T |
|
| Q |
101 |
taaccctaaagatagaag |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
39676424 |
taaccctaaagatagaag |
39676441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 184 - 229
Target Start/End: Original strand, 39676507 - 39676552
Alignment:
| Q |
184 |
atctggtagctgaagcgttaatagaaatgtgtcaccatgtcatacc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39676507 |
atctggtagctgaagcgttaatagaaatgtgtcaccatgtcatacc |
39676552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University