View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2846_low_38 (Length: 235)
Name: NF2846_low_38
Description: NF2846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2846_low_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 32 - 221
Target Start/End: Original strand, 41995517 - 41995706
Alignment:
| Q |
32 |
gtttgatatcccattctaaacggtaataagacataacatgttctttaaaaa-gaaaagacacgacatgtnnnnnnntgaagagcgtatataaacagatag |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| ||||| |||||| |||||||||||||||| |
|
|
| T |
41995517 |
gtttgatatcccattctaaacggtaataagacatgacatgttctttaaaaaagaaaagacacggcatgtaaaaaa-tgaagacagtatataaacagatag |
41995615 |
T |
 |
| Q |
131 |
aattctaagnnnnnnnngacgaggaaaaagttctaggttgaacttgaaattttatgaacggttcggtttgattcaattttatgggtttttt |
221 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41995616 |
aattctaagtttctttcgacgaggaaaaagttttaggttgaacttgaaattttatgaacggttcggtttgattcaattttatgggtttttt |
41995706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University