View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2846_low_42 (Length: 213)
Name: NF2846_low_42
Description: NF2846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2846_low_42 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 32543045 - 32543257
Alignment:
| Q |
1 |
aaattctgtaccatatctgtttccagtgatggactggactcgacaaatgttgactttagtttgaaatccacacgactgcactcatccatcaccttgataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32543045 |
aaattctgtaccatatctgtttccagtgatggactggactcgacaaatgttgacttcagtttgaaatccacacgactgcactcatccatcaccttgataa |
32543144 |
T |
|
| Q |
101 |
ttgtagtttctggaatttcagtatccataaacatatctgaattttctgacaattttgataagcgcctgcgaacactgaaagttaacggtttcaactcatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32543145 |
ttgtagtttctggaatttcagtatccataagcatatctgaattttctgacaattttgataagcgcctgcgaacactgaaagttaacggtttcaactcatt |
32543244 |
T |
|
| Q |
201 |
attcatagaagct |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
32543245 |
attcatagaagct |
32543257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University