View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2847_high_4 (Length: 311)
Name: NF2847_high_4
Description: NF2847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2847_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 44 - 293
Target Start/End: Original strand, 32266852 - 32267101
Alignment:
| Q |
44 |
gattgagtatcctcctccatcatagccttgttgatctttttctctttctcagaatgagaagccatgtgtccacaaagtgctttcaatgaaggaaaacctt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32266852 |
gattgagtatcctcctccatcatagccttgttgatctttttctctttctcagaatgagaagccatgtgtccacaaagtgctttcaatgaaggaaaacctt |
32266951 |
T |
|
| Q |
144 |
tcccacattctttgcagaatttgatcatttcattttgttccaatgtggttnnnnnnnnnnnnnnnnnntgatgattataatgatgatgatgagaatgcac |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32266952 |
tcccacattctttgcagaatttgatcatttcattttgttccaatgtggttgcagcagcagtagcagcatgatgattataatgatgatgatgagaatgcac |
32267051 |
T |
|
| Q |
244 |
aaacctcattgttttcttgggattttctcttagaccataaatgaggtttc |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32267052 |
aaacctcattgttttcttgggattttctcttagaccataaatgaggtttc |
32267101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 86 - 165
Target Start/End: Original strand, 19301397 - 19301476
Alignment:
| Q |
86 |
tctttctcagaatgagaagccatgtgtccacaaagtgctttcaatgaaggaaaacctttcccacattctttgcagaattt |
165 |
Q |
| |
|
||||||||||| ||| |||||||||| ||||| |||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
19301397 |
tctttctcagagtgacaagccatgtgaccacacagtgctttcaatgatggaaaaccttttccacattctttgcagaattt |
19301476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 239 - 291
Target Start/End: Original strand, 19301508 - 19301560
Alignment:
| Q |
239 |
tgcacaaacctcattgttttcttgggattttctcttagaccataaatgaggtt |
291 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||| ||||||||||| ||||| |
|
|
| T |
19301508 |
tgcacaaacctagttgttttcttgggattctctctaagaccataaataaggtt |
19301560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University