View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2847_low_6 (Length: 297)
Name: NF2847_low_6
Description: NF2847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2847_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 41 - 279
Target Start/End: Complemental strand, 41981601 - 41981366
Alignment:
| Q |
41 |
catctttttcctctggtaactactactctaccgaatacttttgtatgttcggtatcaggtgagtttgtcgaaatatacgtaagtgactcatatcatcttg |
140 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||| |||||||||||||||| ||||| ||||||| ||||||||||||||||||| ||||| ||||||| |
|
|
| T |
41981601 |
catcttttccctttggtaactactactctaccgagtacttttgtatgttcgatatcaaatgagtttatcgaaatatacgtaagtgagtcataccatcttg |
41981502 |
T |
|
| Q |
141 |
caaaagatacaaaatgaacttttgcaaaatgaaattccacaccaactcatcgtaatttcgacaaacttatcgaagaaacacnnnnnnnnnnnaaattact |
240 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
41981501 |
caaaa-atacaaaatgaacttttgcaaaatgaaattcgacaccaactcatcgtaatttcgacaaacttatcaaagaaaca--tttttttttttaattact |
41981405 |
T |
|
| Q |
241 |
attaactatttccattcaaaatattttcaggtaacttgt |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41981404 |
attaactatttccattcaaaatattttcaggtaacttgt |
41981366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University