View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2848_high_43 (Length: 304)
Name: NF2848_high_43
Description: NF2848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2848_high_43 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 194 - 288
Target Start/End: Original strand, 39680430 - 39680524
Alignment:
| Q |
194 |
ggtgaaaaattgaaatccaccacaagaacgttaaatcatattgggatttcagttacatgtgaaaaaagaggacctttggtgataatttccatctg |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39680430 |
ggtgaaaaattgaaatccaccacaagaacgttaaatcatattgggatttcagttacatgtgaaaaaagaggacctttggtgataatttccatctg |
39680524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 15 - 137
Target Start/End: Original strand, 39680250 - 39680372
Alignment:
| Q |
15 |
gtttttgtttttgttatccccaccaaacaacaatgttgttcnnnnnnnnnnnnnngtcttttgaatttccatgcatttactaacgcttgtttccgttaca |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39680250 |
gtttttgtttttgttatccccaccaaacaacaatgttgttcttttttttttttttgtcttttgaatttccatgcatttactaacgcttgtttccgttaca |
39680349 |
T |
 |
| Q |
115 |
agtaacattctcaaagacttcaa |
137 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
39680350 |
agtaacattctcaaagacttcaa |
39680372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University