View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2848_high_64 (Length: 250)
Name: NF2848_high_64
Description: NF2848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2848_high_64 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 30349200 - 30349443
Alignment:
| Q |
1 |
aatataaatcaaggttacatgcacttgcatgtgcgcccggaaacaaattcacattggaagagtcttgtccgtgagtaaggagcatgtgatggaaaacagg |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30349200 |
aatataaatcaaggttacatacacttgcatgtgcgcccggaaacaaattcacattggaagagtcttgtccgtgagtaaggagcatgtgatggaaaacagg |
30349299 |
T |
|
| Q |
101 |
aatgaagtgtaccttcctagtctgtctttgattgcttgcattgtgtttttgtatgtactcagcagctgcatagacagttaaagccaaagtggatgcataa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30349300 |
aatgaagtgtaccttcctagtctgtctttgattgcttgcattgtgtttttgtatgtactcagcagctgcatagacagttaaagccaaagtggatgcataa |
30349399 |
T |
|
| Q |
201 |
tgaacgtaaaacactatgcagaacacagagaaaccctttgcttc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30349400 |
tgaacgtaaaacactatgcagaacacagagaaaccctttgcttc |
30349443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University