View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2848_high_66 (Length: 249)
Name: NF2848_high_66
Description: NF2848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2848_high_66 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 71 - 243
Target Start/End: Complemental strand, 38028784 - 38028612
Alignment:
| Q |
71 |
tgctttcttacttgttttgtgtttccattaaaaactctttgatctgatccatttttagagtggagtgttaataagtctatgaacgacaacaagattgtgc |
170 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38028784 |
tgcttccttacttgttttgtgtttccattaaaaactctttgatctgatccatttttagagtggagtgttaataagtctatgaacgacaacaagattgtgc |
38028685 |
T |
 |
| Q |
171 |
agatattgaaactttttgttgtgctactcttagatagcatcaccatttttccctcaccttgatgtctctgctc |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
38028684 |
agatattgaaactttttgttgtgctactcttagatagcatcactatttttccctcaccttgatgcctctgctc |
38028612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 70
Target Start/End: Original strand, 15150837 - 15150883
Alignment:
| Q |
24 |
tagttttcactttccgttatttgttattgcttaattttaatcttaat |
70 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
15150837 |
tagttttcactttctgttatttgttattgcaatattttaatcttaat |
15150883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University