View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2848_low_26 (Length: 379)
Name: NF2848_low_26
Description: NF2848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2848_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-131; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 111 - 360
Target Start/End: Complemental strand, 32927623 - 32927375
Alignment:
| Q |
111 |
tgaattgaactaaagcagaccgtgaagccaaattgaattggacccaaagcagcaataagaacacaaaatagaaccgaaactgaatcccgcataaccgaag |
210 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32927623 |
tgaattgaactaaa-cagaccgtgaagccaaattgaattggacccaaagcagcaataagaacacaaaatagaaccgaaactgaatcccgcataacagaag |
32927525 |
T |
 |
| Q |
211 |
tagttgaacccataacactagattgtcttgaacccattttataccaactacccgtatgaagaaacggtttctgaagatcccttccatcaccactctcttc |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32927524 |
tagttgaacccataacactagattgtcttgaacccattttataccaactacccgtatgaagaaacggtttctgaagatcccttccatcaccactctcttc |
32927425 |
T |
 |
| Q |
311 |
tctgaaactcatcttcttaacccaaaaggtgtttgtgaaaatgtctcaga |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32927424 |
tctgaaactcatcttcttaacccaaaaggtgtttgtgaaaatgtctcaga |
32927375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University