View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2848_low_32 (Length: 360)
Name: NF2848_low_32
Description: NF2848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2848_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 5e-50; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 89 - 213
Target Start/End: Original strand, 27623248 - 27623372
Alignment:
| Q |
89 |
gatgcaaaaagaataacaaaactcacttgtgtcnnnnnnnnctctcttcattttctttataatctttgagaccctacattacataaaacaagtaaggaaa |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27623248 |
gatgcaaaaagaataacaaaactcacttgtgtcttttttttctctcttcattttctttataatctttgagaccctacattacataaaacaagtaaggaaa |
27623347 |
T |
|
| Q |
189 |
aagggtagatctgggtcataaaaat |
213 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
27623348 |
aagggtagatctgggtcataaaaat |
27623372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 327 - 356
Target Start/End: Original strand, 27623489 - 27623518
Alignment:
| Q |
327 |
gtcatttttagggtcatttagaaatttcat |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
27623489 |
gtcatttttagggtcatttagaaatttcat |
27623518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University