View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2848_low_43 (Length: 317)
Name: NF2848_low_43
Description: NF2848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2848_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 80 - 297
Target Start/End: Complemental strand, 32573532 - 32573315
Alignment:
| Q |
80 |
ttaatagtattattttgttacnnnnnnncattacaacagaatcatatgaatgtgacattgctgctgattgtccacctcatatgtatttgtataaagctac |
179 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32573532 |
ttaatagtattattttgttactttttttcattacagcagaatcacatgaatgtgacattgctgctgattgtccacctcatatgtatttgtataaagctac |
32573433 |
T |
 |
| Q |
180 |
gtgtgttagtcgtttgtgtatatatggattaaggtggcattgagggtggaatcaatgttggacacttctttcctgcttcagtttacacaatgagactatc |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32573432 |
gtgtgttagtcgtttgtgtatatatggattaaggtggcattgagggtggaatcaatgttggacacttctttcctgcttcagtttacacaatgagactatc |
32573333 |
T |
 |
| Q |
280 |
attattaatattgctctt |
297 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
32573332 |
attattaatattgctctt |
32573315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University