View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2848_low_47 (Length: 312)
Name: NF2848_low_47
Description: NF2848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2848_low_47 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 4e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 26 - 299
Target Start/End: Complemental strand, 10482583 - 10482310
Alignment:
| Q |
26 |
aagttcgactaaactcatttctagccttgggtcttaggtgcaagtgtgtttgccaaacnnnnnnnnnnnnnnnnnnnaaaattatcatatttgttaagag |
125 |
Q |
| |
|
||||| |||| ||||||||||||| ||||||||||| ||||||||||||||||||||| |||| |||||||||| |||| || |
|
|
| T |
10482583 |
aagtttgactcaactcatttctagacttgggtcttacgtgcaagtgtgtttgccaaactttttttatcaatttttaaaaaaatatcatattttttaaaag |
10482484 |
T |
 |
| Q |
126 |
aaaagactaagtgacctacataaataaataggtatgtttaaattcaagaattgcccatctctagggtaaaataatcctcaaccttaaaagaaatttgaat |
225 |
Q |
| |
|
|||||| ||||||| ||||||||||||| ||||||||||||| || |||||||||||| || ||||||||||||||||||| |||||||| ||||| |
|
|
| T |
10482483 |
aaaagagaaagtgacatacataaataaatgggtatgtttaaatataaaaattgcccatctttaaggtaaaataatcctcaaccctaaaagaagcttgaac |
10482384 |
T |
 |
| Q |
226 |
tatgttttcctccccttttatgttaaaacatatagtcatgtttcctcttatgcaaaagatattattgggtatga |
299 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10482383 |
tatgctttcctccccttttatgttaaaacatatagtcatgtttcctcttatgcaaaagatattattgggtatga |
10482310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University