View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2848_low_66 (Length: 257)
Name: NF2848_low_66
Description: NF2848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2848_low_66 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 65; Significance: 1e-28; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 20 - 140
Target Start/End: Complemental strand, 22069207 - 22069088
Alignment:
| Q |
20 |
gtgccttttttggagaattggagctgtaacgctgaaccctaatacttgtgnnnnnnnnnnnnngacaaaccctaatacttttgttgtttgacgaaaacaa |
119 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
22069207 |
gtgccgtttttggagaattggagctgtaacgctgaaccctaatacttgtgttttttattttt-gacaaaccctagtacttttgttgtttgacgaaaacaa |
22069109 |
T |
 |
| Q |
120 |
ataaagatgtgtattagtgga |
140 |
Q |
| |
|
||||||||||||||| ||||| |
|
|
| T |
22069108 |
ataaagatgtgtatttgtgga |
22069088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 137 - 222
Target Start/End: Complemental strand, 22069059 - 22068974
Alignment:
| Q |
137 |
tggaagacattttctcttttggataagtttgattccatannnnnnnnctataacaaacaaatgatatactttctctccaacaaaca |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
22069059 |
tggaagacattttctcttttggataagtttcattccatattttttttctataacaaacaattgatatactttctctccaacaaaca |
22068974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 28 - 66
Target Start/End: Complemental strand, 22087701 - 22087663
Alignment:
| Q |
28 |
tttggagaattggagctgtaacgctgaaccctaatactt |
66 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22087701 |
tttggagaattggagctgaaacgctgaaccctaatactt |
22087663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 187 - 222
Target Start/End: Complemental strand, 22087040 - 22087005
Alignment:
| Q |
187 |
taacaaacaaatgatatactttctctccaacaaaca |
222 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
22087040 |
taacaaacaattgatatactttctctccaacaaaca |
22087005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 66
Target Start/End: Complemental strand, 22062741 - 22062703
Alignment:
| Q |
28 |
tttggagaattggagctgtaacgctgaaccctaatactt |
66 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
22062741 |
tttggtgaattggagctgaaacgctgaaccctaatactt |
22062703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University