View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2848_low_68 (Length: 256)

Name: NF2848_low_68
Description: NF2848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2848_low_68
NF2848_low_68
[»] chr1 (1 HSPs)
chr1 (20-240)||(37267532-37267758)


Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 20 - 240
Target Start/End: Original strand, 37267532 - 37267758
Alignment:
20 attgtgatcgagtggggaagaatatgaggtaagtggggtacaaaattcaacttccaacatactggacaagtggggac------gtggacgtgtagcagaa 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      |||||||||||||||||    
37267532 attgtgatcgagtggggaagaatatgaggtaagtggggtacaaaattcaacttccaacatactggacaagtggggacgtggacgtggacgtgtagcagaa 37267631  T
114 aacataggtgttggatgtatgaaaaaacttcaacttccatcgtgaaaaggtttcaccatatagtaggtgattaacttatgtagggaaaattatttgccaa 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37267632 aacataggtgttggatgtatgaaaaaacttcaacttccatcgtgaaaaggtttcaccatatagtaggtgattaacttatgtagggaaaattatttgccaa 37267731  T
214 taaaatatggtataaatatgtcttcat 240  Q
    ||||||||||||||||||| |||||||    
37267732 taaaatatggtataaatatatcttcat 37267758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University