View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2848_low_68 (Length: 256)
Name: NF2848_low_68
Description: NF2848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2848_low_68 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 20 - 240
Target Start/End: Original strand, 37267532 - 37267758
Alignment:
| Q |
20 |
attgtgatcgagtggggaagaatatgaggtaagtggggtacaaaattcaacttccaacatactggacaagtggggac------gtggacgtgtagcagaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37267532 |
attgtgatcgagtggggaagaatatgaggtaagtggggtacaaaattcaacttccaacatactggacaagtggggacgtggacgtggacgtgtagcagaa |
37267631 |
T |
 |
| Q |
114 |
aacataggtgttggatgtatgaaaaaacttcaacttccatcgtgaaaaggtttcaccatatagtaggtgattaacttatgtagggaaaattatttgccaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37267632 |
aacataggtgttggatgtatgaaaaaacttcaacttccatcgtgaaaaggtttcaccatatagtaggtgattaacttatgtagggaaaattatttgccaa |
37267731 |
T |
 |
| Q |
214 |
taaaatatggtataaatatgtcttcat |
240 |
Q |
| |
|
||||||||||||||||||| ||||||| |
|
|
| T |
37267732 |
taaaatatggtataaatatatcttcat |
37267758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University