View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2848_low_72 (Length: 251)
Name: NF2848_low_72
Description: NF2848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2848_low_72 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 16 - 233
Target Start/End: Original strand, 42212675 - 42212892
Alignment:
| Q |
16 |
attcattgggaagataatcaccattcaaatgtaagatctggtgtaataaaataagtactcttttataatataaaagaaagtacgctttttattannnnnn |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
42212675 |
attcattgggaagataatcaccattcaaatataagatctggtgtaataaaataagtactcttttatgatataaaagaaagtgcgctttttattatttttt |
42212774 |
T |
 |
| Q |
116 |
ngaaaaggcaaagtactctttcaattgagagtgcaaactctgtattttagatccaaacgtcgtcatgaaatagaatagctacatgcatcatataaataaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42212775 |
tgaaaaggcaaagtactctttcaattgagagtgcaaactctgtattttagatccaaacgctgtcatgaaatagaatagctacatgcatcatataaataaa |
42212874 |
T |
 |
| Q |
216 |
tattagtgacttgcacac |
233 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
42212875 |
tattagtgacttgcacac |
42212892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University